English   español  
Por favor, use este identificador para citar o enlazar a este item: http://hdl.handle.net/10261/50981

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis

AutorUhía, I. ; Galán, Beatriz ; Medrano, Francisco Javier; García, José Luis
Fecha de publicación1-sep-2011
EditorSociety for General Microbiology
CitaciónMicrobiology, 157 (9) : 2670-2680 (2011)
ResumenThe KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSDMS) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P5228 promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5′ untranslated region (5′UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the −5 and −35 positions with respect to the transcription start site. This region overlaps with the −10 and −35 boxes of the P5228 promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P5228–β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P5228 promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism
Descripción11 páginas, 6 figuras, 2 tablas -- PAGS nros. 2670-2680
Versión del editorhttp://dx.doi.org/10.1099/mic.0.049213-0
Aparece en las colecciones: (CIB) Artículos
Ficheros en este ítem:
No hay ficheros asociados a este ítem.
Mostrar el registro completo

Artículos relacionados:

NOTA: Los ítems de Digital.CSIC están protegidos por copyright, con todos los derechos reservados, a menos que se indique lo contrario.