Keywords: Mytilus; Mussel; Antimicrobial peptides; Myticin; Innate immunity

Abbreviations: aa, amino acids; AMP, antimicrobial peptide; bp, base pair; cDNA, complementary DNA; cds, coding sequence; CSαβ, cysteine-stabilized α-helix and β-sheet; EST, expressed sequence tag; GO, Gene Ontology; ORF, open reading frame; PAMPs, pathogen-associated molecular patterns; SSH, suppression subtractive hybridization; TLR, Toll-like receptor

Article Outline

1. Introduction

2. Material and methods

2.1. Animals, immune stimulation and hemolymph withdrawal

2.2. SSH and primary cDNA libraries

2.3. ESTs processing and analysis

2.4. New myticin ORF amplification

2.5. Sequence analysis of a new myticin cluster (myticin C)

2.6. Genomic study

2.7. Expression studies by Q-PCR

2.8. Expression of the new myticin cluster in tissues and in early stages of development

3. Results

3.1. cDNA production, sequencing and functional annotation

3.2. Structural features and variability of new myticin transcripts

3.3. Genomic analysis of myticin C

3.4. Expression of myticin C in adult and larval mussel tissues

4. Discussion

Competing interests statement

Acknowledgements

Appendix A. Supplementary data

References

1. Introduction

In multicellular organisms, protection against infectious agents has evolved due to the continuously occurring host/parasite relationships [1] and [2]. Key features of the immune responses are the high intrinsic diversity of the molecules of self/non-self recognition, challenge-specific protection and complex regulatory integration.

The dependence of the immunological memory of vertebrates on pathogen-associated molecular pattern (PAMP) recognition, defence signaling pathways, such as the NF-κB/IκB cascade and the highly diverse sets of molecules counteracting non-self antigens, emphasize the crucial role of innate immune responses, in both vertebrate and invertebrate organisms [1] and [3]. In particular, Toll-like receptors (TLRs) can be regarded as the recognition molecules bridging natural and adaptive immunity. They recognize, for instance, bacterial and viral PAMPs, and are known to activate antimicrobial genes and cytokine production [4] and [5]. The multiplicity and regional hypervariability of the vertebrate-like TLR subfamily (211/220 genes), found in purple sea urchin, highlights the remarkable variety of immune receptors of invertebrates [6] and [7]. The presence of other immune-related molecules, like interleukin, interleukin receptors, Rag1/2-like gene clusters and several families of immunoglobulin domain genes in the sea urchin genome, supports a better understanding of natural immunity of invertebrate species [8].

The role of cationic amphipatic molecules known as antimicrobial peptides (AMPs, ancient host defence peptides) is paradigmatic in the natural immunity system [9], [10] and [11]. They share small size (12–50 aa), positive charge as well as hydrophobicity (2–9 lysine/arginines and 50% hydrophobic aminoacids) [10]. Sequence diversity of AMPs can result in α-helix motifs, different number of cystein residues and disulfide bridges, β-hairpin or cyclization. Altogether, specific amino acid positions and structural motifs explain the peptide stability and resistance to proteases, efficient binding to anionic and sugar components of the bacterial cell envelope, membrane pore formation and other antimicrobial effects [11]. Cleavage of the AMP precursor yields biologically active peptides, which are able to interact at nanomolar concentration with the bacterial membrane and to initiate pathogen killing [11] and [12].

Constitutive and induced production of AMPs have been reported, with various expression patterns depending on species, tissue and cell type, infection or inflammation state. These natural antibiotics (>1000 AMPs have been estimated in multicellular organisms) well exemplify the complexity and heterogeneity of immune responses since they can directly kill microbes and act as modifiers of innate and even of adaptive immune responses [10].

In marine invertebrates, constantly surrounded by potentially invading microorganisms, circulating haemocytes are fundamental elements of the defence response since they infiltrate injured tissues, encapsulate or phagocyte microbial cells and release cytotoxic factors such as lectins, complement factors and AMPs [13], [14], [15] and [16]. Mussels especially seem more resistant to infections and diseases than other edible bivalves, such as oysters and clams [17] and [18]. Hence, knowledge of defence mechanisms and specific genes recruited in mussels against potential pathogens may improve the general understanding of the innate immune responses.

In this work, Mediterranean mussels (Mytilus galloprovincialis Lmk., 1919) from the Ría de Vigo (NW of Spain) were immuno-stimulated and a subtractive suppression hybridization (SSH) and random expressed sequence tag (EST) sequencing were used to identify differentially expressed genes with particular interest to those that are immune related. Our results indicate the abundance of AMP messengers and significant sequence diversity of myticins, and, for the first time, we report the consensus sequence of a new gene, myticin C. Molecular features and expression levels of myticin C support the robustness of innate immune responses in marine invertebrates.

2. Material and methods

2.1. Animals, immune stimulation and hemolymph withdrawal

Mediterranean mussels (M. galloprovincialis) with a maximum shell length of 6 cm were obtained from a commercial shellfish farm from the Ría de Vigo (NW of Spain). Animals were maintained in open-circuit filtered seawater (FSW) tanks at 15 °C with aeration and they were fed daily with Isochrysys galbana (12×10⁸ cells/animal), Tetraselmis suecica (10⁷ cells/animal) and Skeletonema costatum (3×10⁸ cells/animal). Prior to the experiments, bivalves were acclimatized for 1 week.

One hundred and fifty mussels were notched at the shell adjacent to the posterior adductor muscle. Fifty mussels were injected into the adductor muscle with 100 μl (containing 10⁷ cells/ml) of a mixture of dead bacteria (Micrococcus lysodeikticus, Vibrio splendidus and Vibrio anguillarum), kindly donated by Philippe Roch from IFREMER (Montpellier, France). Fifty animals were injected with 100 μl of a solution of poly I:C 1 mg/ml (Sigma). The remaining 50 mussels were injected with 100 μl of FSW and were used as control. After the challenge, mussels were returned to the tanks and maintained at 15 °C for 48 h.

Hemolymph (1–2 ml) was withdrawn from the adductor muscle of each animal with a disposable syringe. Hemolymph was individually collected, pooled from each of the three mussel groups and centrifuged at 2500g for 15 min at 4 °C. The pellet was resuspended in 6 ml of Trizol reagent (Invitrogen), and RNA was extracted according to the manufacturer's protocol.

2.2. SSH and primary cDNA libraries

The SSH method [19] was used to detect differentially expressed genes. Briefly, complementary DNA (cDNA) was synthesized from 1 μg of each hemolymph RNA sample (bacterial infected, poly I:C stimulated and control) with the SMART PCR cDNA Synthesis Kit (Clontech), which allows almost full-length cDNA synthesis from mRNA transcripts. A SSH assay was then performed using the PCR-Select cDNA Subtraction Kit (Clontech) following the manufacturer's instruction [20]. The PCR mixture of the differentially expressed cDNAs was cloned with the TOPO TA cloning kit (Invitrogen) and transformed in E. coli (TOP 10F′) competent cells (Invitrogen).

Selected colonies of both SSH libraries (SSH01: bacteria treated vs control and SSH02: poly I:C treated vs control) were amplified by PCR and agarose gel electrophoresis was performed to check and select size-wise the samples to be sequenced. The PCR protocol was the following: initial denaturation was carried out for 5 min at 94 °C, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 65 °C for 30 s and elongation at 72 °C for 1.5 min; the final extension was at 72 °C for 7 min. Excess primers and nucleotides were removed by enzymatic digestion using 10 and 1 U of ExoI and SAP, respectively (Amersham Biosciences), at 37 °C for 1 h followed by inactivation of the enzymes at 80 °C for 15 min. DNA sequencing was performed using a BigDye terminator Cycle Sequencing Ready Reaction Kit and an automated DNA sequencer ABI 3730 (Applied Biosystems).

Primary cDNA libraries were also prepared from the same hemolymph RNA samples (HAE03: from bacterial-treated mussels and HAE04: from poly I:C treated mussels). To this purpose, we developed a combination of SMART (Clontech), exploiting the template-switching effect at the 5′ end and ensuring almost full-length cDNA, and Gateway technology (Invitrogen), allowing unidirectional cloning without restriction enzyme digestion. In this protocol, fully transcribed first strand cDNA is tagged with a short sequence complementary to a modified SMART oligo. The SMART oligo sequence (SMART-16attB1-T3 TACAAAAAAGCAGGCTAATTAACCCTCACTAAAGGG) and the overhang of the oligo (dT) primer (GGGGACCACTTTGTACAAGAAAGCTGGGCGGCCGC[dT]20VN) used for first-strand synthesis include attB1 and attB2 recombination sites, respectively. First-strand cDNA synthesis started from 1.5 μg of total RNA in a 10 μl reaction. Then, the reaction was diluted in 1:5 ratio and incubated at 72 °C for 2 min. Second-strand reaction mix was added to 1 μl of first-strand cDNA to give a final concentration of 1× PCR reaction buffer, 0.2 mM dNTPs, 120 nM attB1-8T3 (GGGGACAAGTTTGTACAAAAAAGCAGGCTAATTAACC) and attB2 (GGGGACCACTTTGTACAAGAAAGCTGGG) primers, and 1 μl of Advantage2 DNA polymerase mix (Clontech) in a volume of 50 μl. This second-strand reaction mixture was incubated for 18 cycles of 95 °C for 15 s, 66 °C for 30 s and 68 °C for 3 min. The second-strand reaction was glass fiber column purified and cDNA was selected size-wise by Sepharose CL-4B SPUN COLUMN (GE Healthcare). The eluted cDNA was quantified and checked on 1% agarose gel.

About 35 ng of attB-cDNA, 150 ng of pDONR221 (Invitrogen) and 2 μl of BP Clonase II (Invitrogen) were used for the recombination reaction (10 μl final volume) performed at 25 °C for 18 h. The reaction was stopped, purified and precipitated and 1/5 reaction was used to transform electrocompetent Escherichia coli DH10B strain. Libraries were arrayed on 96-well plates, PCR amplified and the clone inserts were randomly sequenced from the 5′ end at the local sequencing service of Padova University (http://www.bmr-genomics.it).

2.3. ESTs processing and analysis

Raw chromatograms were analyzed with the trac2dbest software, a part of PartiGene pipeline available at http://www.nematodes.org/bioinformatics/annot8r/index.shtml. Clustering, protein prediction and Gene Ontology (GO) annotation have also been performed with PartiGene by means of the Prot4EST and Annot8r software.

Each sequence was subjected to BLASTx alignment against the non-redundant protein database [21]. Alignments generating expectation values 10⁻⁴ were retained to describe the putative gene function. Afterwards, BLASTn analysis was performed to annotate ribosomal and mitochondrial mussel transcripts (expectation value 0.0).

Limiting the analysis to Hae03 and Hae04, we used the EST frequency of independent transcripts (not counting mitochondrial and ribosomal ESTs) to compute the probability of differential gene expression, i.e. the statistical significance of differences in transcript frequency, by means of the Audic and Claverie test [22] available at http://telethon.bio.unipd.it/bioinfo/IDEG6_form/ [23].

The test is designed to calculate differential expression probabilities by comparing EST frequencies of unequal EST pools. It was performed only if more than three gene-specific ESTs were collected in either library and if the EST number was different. This web tool was also used to infer differential GO categories representation within the four libraries using the R test [24].

2.4. New myticin ORF amplification

The open reading frames (ORFs) of the ESTs that showed homology with myticins but were different from myticin A and B, were further studied. Primers derived from conserved regions of those new myticin forms with the complete coding sequence (cds) were designed in order to obtain the total ORF from the remaining incomplete sequences. The primer forward Myticin-7F-F (5′ATATTCCTCAAAACTCAAAACATTCA3′) and the primer reverse, Myticin-7F-R (5′TTCAAGCTGAAAACGTCGAA3′) were used for amplification of the myticin forms by PCR of the previously obtained cDNAs. The PCR profile consisted of initial denaturation at 94 °C for 5 min, 40 cycles of denaturation at 94 °C for 60 s, annealing at 50 °C for 60 s and elongation at 72 °C for 60 s; the final extension was at 72 °C for 10 min. The products obtained were sequenced as described previously for the SSH libraries.

2.5. Sequence analysis of a new myticin cluster (myticin C)

The myticin ESTs differing from myticins A and B were manually inspected and only full-length sequences were taken into account for translation and multiple alignment (ClustalW algorithm, available at http://www.ebi.ac.uk/clustalw/). Phenetic analysis of the new myticins was performed with the MEGA software package [25]. The unweighted pair group method with arithmetic mean clustering coupled with the substitution model JTT and 500 bootstrap replicates was used to establish the relative distances among AMP variants from the comparison of molecular data.

The presence of a signal peptide and location of cleavage sites was evaluated with the SignalIP 3.0 software at http://www.cbs.dtu.dk/services/SignalP/ [26]. Porter software program [27] was used to predict α-helix, β-sheet and coil motifs in the secondary structure of myticin C.

2.6. Genomic study

In order to study the genomic individual variability, total DNA from nine different mussels was extracted using DNAzol (Invitrogen). PCR was performed using the pair of conserved primers described previously (Myticin-7F F/R) in order to amplify myticin C from the genomic DNA, thus undertaking a preliminary assessment of the polymorphism level. Following cloning of individual PCR products, 3–5 clones per mussel were randomly selected and subjected to single-pass sequencing (33 total sequences). For one mussel, a total of 13 clone inserts were completely sequenced in forward and reverse directions to verify if the new myticin variants were coded by a single locus. Overall, 46 partial gene sequences of myticin C were obtained.

The β-actin gene was selected to perform the same experiment as a control. PCR was carried out to amplify a segment from β-actin using the following primers: mussel act-F (5′AACCGCCGCTTCTTCATCTTC3′) and mussel act-R (5′TACCACCAGACAAGACGG 3′). The PCR profile consisted of initial denaturation at 94 °C for 5 min, 40 cycles of denaturation at 94 °C for 60 s, annealing at 50 °C for 60 s and elongation at 72 °C for 60 s; the final extension was for 10 min at 72 °C.

2.7. Expression studies by Q-PCR

To study and quantify the differential expression of the new myticins, a real-time SYBR Green PCR assay was carried out with the total hemocytes cDNA obtained from infected bacteria, poly I:C stimulated and non-infected control. The 25 μl PCR mixture consisted of 12.5 μl of SYBR Green master mix (ABI Biosystems, USA) with 0.5 μl of primer pairs 10 μM Myticin-7F-F (forward) and Myticin-7F-R (reverse) and 1 μl of the cDNA. Amplification was carried out at 95 °C for 10 min, followed by 40 cycles in two steps: 95 °C for 15 s and 60 °C for 1 min. The assays were performed using the 7300 Real Time PCR System (Applied Biosystems). The comparative CT method (2-ΔΔCT method) was used to determine the expression level of analyzed genes [28]. Expression of the candidate genes was normalized using β-actin as a housekeeping gene. Fold units were calculated dividing the normalized expression values of infected tissues by the normalized expression values of the controls. Results were expressed as the mean±standard deviation. Data were analyzed using a Student's t-test and differences were considered statistically significant at p<0.05.

2.8. Expression of the new myticin cluster in tissues and in early stages of development

RNA from several tissues of naive mussels (hemocytes, gills, mantle, muscle, gonad and digestive gland) were isolated following the Trizol reagent's instructions. A total of 5 μg of RNA was used to obtain cDNA using the SuperScript II Reverse Transcriptase (Invitrogen). The resulting cDNAs were used to amplify the new myticin cluster by PCR in order to determine if there was a constitutive expression.

The spawning of 10 individual mussels was induced by increasing the seawater temperature 4–5 °C and maintaining the animals out of the water for 30 min. Mussels were placed in independent tanks of 1 l capacity. The quality of gametes from individual mussels was determined under a light microscope and the number of cells was quantified in a Neubauer chamber. A proportion of 10:1 (spermatozoid:oocyte) was used to induce fecundation. Aliquots from the same samples used in fecundation were centrifuged at 2000g for 10 min at 4 °C. Pellets with gametes were resuspended in 6 ml of Trizol and maintained at −80 °C until RNA was isolated. Larvae were collected 2 and 24 h post fertilization by centrifugation at 2000g and resuspended in 6 ml of Trizol. RNA isolation and retrotranscription were conducted as described previously. The cDNAs obtained were used as templates to amplify the new myticin using Myticin-7F-F/R as primers.

3. Results

3.1. cDNA production, sequencing and functional annotation

A total of 1304 ESTs were processed and 1147 reliable sequences (88% of the total) were obtained ranging in length from 399 to 527 bp, representing 247 singleton sequences. The other 900 ESTs were grouped in 111 clusters. These data reveal a value of redundancy of 78.5% (Table 1). Only 215 transcript tags were assigned a putative function.

Table 1.

Overall description of the ESTs identified by SSH and random sequencing in the hemolymph of immuno-stimulated mussels

Library	Traces processed	Trimmed traces	Average length (bp)
Summary of trace analysis
SSH01	150	127 (84%)	399
SSH02	53	53 (100%)	413
Hae03	528	457 (86%)	494
Hae04	573	510 (89%)	527
Total	1304	1147 (88%)	494
Summary of clustering
Number of sequences		1147
Total number of transcripts		358
Number of singletons		247
Number of clusters		111
Redundancy (ESTs in clusters/total ESTs)		78.5%
Summary of similarity annotation		Transcripts	ESTs
No similarity hit (e-value<e−4)		143	235
Partial similarity (e-30<e-value>e−4)		108	431
High similarity (e-value>e−30)		107	481

SSH01 and HAE03: injection of dead bacteria; SSHO2 and HAE4: injection of poly I:C. Redundancy indicates the number of ESTs assembled in clusters/total ESTs. The e-values refer to BLASTx similarity searches (non-redundant databases, January 2007).

According to the knowledge domains of GO Slim, the cut-down version of GO available at http://www.geneontology.org/ [29], genes involved in biological processes of response to stimuli (28–29% and 32–49% ESTs from mussels injected with dead bacteria and poly I:C, respectively) and metabolic processes (21–32% and 24–27% ESTs) constitute the biggest part of the transcriptional hemocyte response (Table 2). Sequences related to specific molecular functions such as binding, catalytic activity and structural molecule activity appear selectively rescued by SSH libraries, namely molecular functions particularly involved in the response of external stimuli (transcript ID, relative EST frequency and annotation details are listed in Supplementary Table 1).

Table 2.

EST classification according to Gene Ontology (GO: 0008150 biological process)

		Total	SSH01	SSH02	Hae03	Hae04
Biological process
GO:0050896	Response to stimulus	31.12	28.35	49.06	28.45	32.35
GO:0008152	Metabolic process	24.24	31.50	26.42	21.66	24.51
GO:0006810	Transport	8.63	13.39	5.66	6.78	9.41
GO:0009987	Cellular process	2.88	4.72	9.43	1.97	2.55
GO:0006118	Electron transport	2.70	7.09	1.89	2.41	1.96
GO:0006139	Nucleobase, nucleoside, nucleotide and nucleic acid metabolism	1.13	0.79	5.66	0.88	0.98
GO:0007154	Cell communication	0.96	3.15	0.00	0.22	1.18
GO:0008219	Cell death	0.87	1.57	0.00	1.09	0.59
GO:0009405	Pathogenesis	0.78	1.57	0.00	1.09	0.39
GO:0007275	Development	0.35	0.00	1.89	0.00	0.59
GO:0050789	Regulation of biological process	0.09	0.00	0.00	0.00	0.20
Molecular function total
GO:0005488	Binding	13.69	33.07	28.30	8.32	12.16
GO:0003824	Catalytic activity	8.46	14.96	9.43	7.22	7.84
GO:0005198	Structural molecule activity	5.49	14.96	3.77	4.38	4.31
GO:0003676	Nucleic acid binding	2.09	10.24	3.77	0.88	0.98
GO:0004871	Signal transducer activity	0.78	0.00	0.00	0.88	0.98
GO:0003774	Motor activity	0.26	0.00	1.89	0.00	0.39
GO:0030234	Enzyme regulator activity	0.09	0.00	1.89	0.00	0.00

GO annotation files, February 07 (see Section 2).

Among the genes actively transcribed or differentially expressed in the hemolymph of the immuno-stimulated mussels, AMPs were the most abundant. In detail, 22 independent EST clusters (411 ESTs) were putatively identified as precursors of myticins (56.6%, isoforms A and B), mytilins (40%, isoforms A and B) and defensin (3.4%). In the applied experimental conditions, poly I:C was a more potent immuno-stimulant than the bacterial cocktail as the AMPs summed from SSH01 and HAE03 and from SSH02 and HAE04 were 31% and 41%, respectively.

Despite the functional role of many sequenced ESTs still being unknown, other immune-related and response genes were putatively identified, which comprised of various lectins (37 ESTs grouped in 12 independent clusters: MGC00027/29/51/112/113/145/168/260/307/418/497/542), the regulatory allograft inflammatory factor-1-related protein (3 ESTs grouped in 2 clusters: MGC00176/355) and lysozyme (2 ESTs grouped in 1 cluster: MGC00151). Interestingly, a transcript well represented in all the 4 libraries (77 ESTs grouped in 5 clusters: MCG00005/53/69/191/282), and similar to an oyster mantle gene, contains the tumor necrosis factor-like and the complement-related C1q domains (InterProScan analysis was performed online at http://www.ebi.ac.uk/Tools/webservices/) [30].

Another remarkable EST, related to immune defense mechanisms and involved in hemocyte adhesion, dermatopontin 3, was also found in our libraries (8 ESTs grouped in 2 clusters: MGC00088/350). A total of 7 ESTs with homology to heat-shock protein 90 (HSP90) and grouped in three different clusters (MGC00048/533/557) were identified. Although not abundant, 2 tags with similarity to the immunomodulatory peptide β-thymosin-like sequence (2 ESTs grouped in 1 cluster: MGC00037) were observed.

To better evaluate differences in the transcript frequency, the probability of differential gene expression between the two more abundant EST groups, Hae03 and Hae04 (see digital expression analysis in Section 2), was computed. It is important to note that the selected p value was not used to determine the statistical significance of differential regulation and it does not imply fold regulation of a specific gene at the mRNA level within the actual tissue; rather, the probability generated through this statistical analysis reflects a significant difference between gene-specific EST counts sequenced from cloned mRNA populations of differing physiological conditions. Among the transcripts, differentially represented (p<0.01) mussel defensin (MGC00010, 7 ESTs) and 2 unknown clusters (MGC00012, 27 ESTs, MGC00010 and 14 ESTs) were more abundant in mussels injected with dead bacteria. Mytilin B, mytilin C (MGC00001, 73 ESTs; MGC00008, 41 ESTs), the putative mantle gene MCG00005, myticin B (MCG00316, 5 ESTs) and a sialic acid-binding lectin (MCG00307, 5 ESTs) were more abundant in mussels injected with poly I:C.

3.2. Structural features and variability of new myticin transcripts

In the hemolymph of 100 immuno-stimulated mussels, myticin-related ESTs were the most abundant. Following sequence checking and processing, and excluding partial mRNAs from the analysis, 74 variants of the myticin precursors, distinct from myticins A and B were identified, suggestive of high allelic variability (Fig. 1). In addition to the 62 ESTs originating from SSH and random sequencing (SSH01: 1, SSH02: 3, HAE03: 25, HAE04: 33), 12 other sequences were identified by primer design and PCR amplification of the cds of myticin C from the original cDNA samples (amplicon length, 353 bp). Sequence analysis also indicated the extension of 5′ UTR and 3′ UTR (62–74 and 118–315 bp, respectively) and 3 alternative poly-adenylation sites.

Display Full Size version of this image (288K)

Fig. 1. Multiple comparison of the 74 new sequence variants of mussel myticins. Translated full-length precursor sequences of 100 amino acid residues are aligned with the known myticins A (AC: P82103) and B (AC: P82102). A gap was introduced for optimal alignment. Dash indicates identical positions. Dark and light gray indicate putative cleavage sites and the cysteine array, respectively. At the bottom, the mature peptide region and cystein residues are emphasized by numbering 1–40 and C1–C8, respectively; lines show the putative disulfide bonds involved in the CSαβ motif whereas filled bar and arrows depict the expected α-helix and β-sheets.

The new variants were defined by 100 aa residues. Compared to the already known myticin A and B precursors, almost identical segments (only 4/20 variant positions in the N-terminal signal peptide) were found and amino acid variation was particularly evident in the negatively charged C-terminal pro-region (24/40 variant positions and 4 extra residues absent in myticins A and B). The 8-cysteine array typical of myticins and other molluscan AMPs, i.e. C₁-X(4)–C₂-X(3)–C₃-X(4)–C₄-X(4)–C₅-X(8)–C₆-X–C₇-X(2)–C₈, were found in the mature peptide segment (40 aa) of all the new sequences except 3, Mg_SSH02_03B05, Mg_Hae03_07A01 and Mg_Hae04_05C12, which displayed 2, 1 and 1 differences, respectively.

The prediction of secondary structure of the new myticin variants allowed the detection of two β-sheet elements. The same analysis was, however, unable to predict the α-helix in all sequences of mytilins and myticins available. Conversely, this structure was correctly identified in all the mussel defensins. Despite the lack of a detectable α-helix in mytilins and myticins, the C₆-(X)_m–C₇/C₂-(X)_n–C₃ cysteine framework has a m/n=1/3 and strongly suggests that myticin C possesses the cysteine-stabilized α-helical motif as described by Tamaoki et al. [31].

The molecular diversity of the 74 myticin variants was confirmed by phenetic analysis on the entire translated cds in comparison to myticins A and B (Fig. 2A). The new sequences and the known myticins visibly separated into two different branches on the basis of 40.6–53.1% amino acid differences (45.1% on an average). The lower distance observed between myticins A and B (24%) indicate the new variants all together as a third form (19% the maximum difference among the new variants, typically 9.1%). Taking into account the mature peptide only, the molecular diversity of the new myticins reduced from 74 to 25 variants (Fig. 2B), as expected for gene regions with functional constraints. Interestingly, the p-distances among the 25 variants increased to 13.6%.

Display Full Size version of this image (87K)

Fig. 2. Phenetic distance trees of the new mussel myticins. (A) Complete precursor (100 aa, 74 variants); (B) mature peptide region (40 aa, 25 variants). Sequences have been translated for the analysis. The bootstrap tree of the translated sequences was rooted on myticins A and B. The scale bar numerically indicates the magnitude of amino acid differences (JTT substitution rate matrix).

Based on the above molecular data, we propose to identify the highly polymorphic group of new transcripts as a new isoform, namely myticin C.

3.3. Genomic analysis of myticin C

Myticin-7F primer pair was used to amplify the cds of myticin C from the genomic DNA of one individual mussel, labeled as mussel 22 and its gene structure was investigated. Fig. 3 describes the genomic organization of myticin C as deduced from the analysis of one allele with a size of 1250 bp and shows the existence of two introns of 445 and 452 bp each. To test the hypothesis that myticin C could exist as gene clusters other randomly selected clones from the individual 22 were sequenced and all the 17 intron sequences available were clustered in two lineages only (Fig. 4, upper sequences). Based on these data, the existence of a gene cluster is considered unlikely and one single locus is hypothesized.

Display Full Size version of this image (144K)

Fig. 3. Partial reconstruction of the genomic architecture of myticin C. Translated cds and genomic sequence are shown as modified output file of NAP, available at http://genome.cs.mtu.edu/align.html and representing a randomly chosen individual sequence. The splicing sites and the stop codon are in bold. The mature peptide region is underlined. Two arrows indicate the position of the primers used to amplify myticin C from genomic DNA.

Display Full Size version of this image (69K)

Fig. 4. Phenetic distance tree of 14 genomic variants of myticin C: intron region. Forty-six sequences of variable length (445–639 nucleotides) from 9 individual mussels have been compared (redundant clone sequencing of mussel 22 suggests 2 alleles of one single gene and allows the estimation of artifactual sequence differences). The scale bar numerically indicates the Tajima-Nei distances [32].

The differences in size and sequence detected in the genomic analysis led us to investigate the allelic variability of myticin C locus. Following cloning of the PCR products from 8 additional mussels and single pass insert sequencing, a total of 46 partial gene sequences (17 of them from the redundant sequencing of mussel 22) were obtained, curiously showing different intron sizes among individual mussels (445, 480 and >615 bp).

The bootstrap distance tree calculated for all the resulting 46 sequences of the first intron, preceding the mature peptide region, clearly indicated no more than 2 individual alleles per mussel and the existence of one gene copy of myticin C per genome (Fig. 4). Fig. 4 also indicates the great variability of such introns since as much as 14 variants could be identified in 9 individual mussels. Despite the above, estimates should be based on a more extended analysis. The nucleotide variability of the intron region corresponded to astonishing values of gene diversity (1.0 H_o and 0.919 H_e, observed heterozygosity and expected heterozygosity, respectively, under Hardy–Weinberg equilibrium, as estimated from where p_i is the frequency of the ith of k alleles).

To evaluate the extent to which the molecular variability detected in myticin C is a distinctive characteristic of this AMP, the sequence variation of a non-immune-related gene, β-actin, was investigated. All the amplified and sequenced individual clone inserts (234 bp amplicon size) showed the same sequence, except two individual nucleotide changes (data not shown). This finding suggests that the rate of hypervariability in the myticin C locus is higher than in a non-immune gene, which could indicate an elevated mutation rate in adaptively evolving gene regions.

3.4. Expression of myticin C in adult and larval mussel tissues

Quantitative PCR analysis was performed to determine the relative expression pattern of the myticin C using conserved primers in all the myticin C forms. The results obtained when normalized to β-actin, used as housekeeping gene, showed a significant induction of the expression levels of myticin C, after treating the mussels with dead bacteria or poly I:C (Fig. 5A). Myticin C was expressed constitutively in naive mussels in all the tissues analyzed (Fig. 5B), the mantle being the organ in which this AMP seems to be highly expressed. We used the same specific primers herein designed to also analyze the expression of the myticin C at early developmental stages. Fig. 5C shows that myticin expression was strongly detected in oocytes and in larvae collected 2 and 24 h post fertilization, though lighter than in oocytes.

Display Full Size version of this image (27K)

Fig. 5. Expression of myticin C in different developmental stages and tissues. (A) Validation by quantitative PCR of myticin C expression in hemocyte samples from treated and control mussels. Results are mean±SD. Bars represent the relative expression transcript levels normalized to β-actin levels. (B) Agarose gel showing transcripts of myticin C and β-actin expressed in different mussel tissues: (1) hemocytes; (2) gills; (3) mantle; (4) muscle; (5) gonad; (6) digestive gland (7) negative control. (C) Expression of myticin C and β-actin during mussel development: (1) oocytes; (2) mussel larvae collected 2 h post fertilization and (3) 24 h post fertilization.

4. Discussion

Despite the growing economic importance of bivalve culture, little is known about the molecular basis of their immune response. cDNA and SSH libraries have been recently used to detect differentially expressed genes and also to identify immune-related transcripts in aquatic species, particularly bivalves [33], [34], [35], [36] and [37]. In the present work, SSH and cDNA libraries were instrumental in detecting genes actively expressed in hemocytes of the immune-stimulated (heat-killed bacteria and poly I:C) mussels. Due to the paucity of sequence records publicly available (4578 nucleotide and 281 protein records for M. galloprovincialis at NCBI), only 275 from the 1147 ESTs obtained, were assigned a putative function. Sequences related to specific molecular functions such as binding, catalytic activity and structural molecule binding appear to be selectively rescued by SSH libraries, namely molecular functions particularly involved in the response to external stimuli.

Overall, the transcriptional response to the described treatments indicated a striking prevalence of not only the AMPs, mainly myticins, but also mytilins and defensins. Interestingly, the antifungal peptide, mytimycin, partially characterized from Mytilus edulis plasma [38] has not been found in these data sets. Other immune-related ESTs such as lectins have also been detected in our libraries including C-type lectins and tachylectins. Among the humoral components of the immune system of bivalves, lysozyme and several ESTs with homology to the stress protein HSP90 were also found.

In our opinion, the most interesting result found in our libraries is the high number of ESTs with similarity to AMPs. AMPs are downstream effectors of the immune response, considerably varying in primary structures, length and number of positive charges [39]. Besides the transcripts with homology to the AMPs described previously in the literature (myticin A and B), a third highly polymorphic isoform, myticin C, seems to exist. Even with a more conservative estimate of sequence differences based on elimination of errors potentially resulting from DNA amplification, the number of myticin C variants differing in at least 2 aa appears remarkable (46 peptide precursor of 100 aa and 15 mature peptide of 40 aa in a sample of 100 mussels).

In spite of the high variability in sequence of certain regions and possible differences in the element organization, AMPs share molecular features defining constrained secondary structures and a 3D gamma g-core motif essential for microbial killing [40]. Forming intra-molecular disulfide bridges, such as the consensus cysteine array, stabilizes a single α-helix and a pair of anti-parallel β-sheets, the structural motif cysteine-stabilized α-helix and β-sheet (CSαβ) is common to a great number of diverse peptides [41]. Indeed, the known mussel defensins and myticins share the CSαβ motif and are essentially active against Gram-positive bacteria, like the Vibrio strains used for immuno-stimulation. Considering the close position of the N-terminal region to the loop defined by the anti-parallel β-elements, some of the amino acid variations detected in myticin C could influence the effectiveness of antimicrobial killing [42].

Even though there is a large sequence diversity, the genomic organization of myticin C and mytilin B shows some common features and differs from that of molluscan defensins. For instance, the exon encoding the mature peptide is not split by an intron and the introns flanking the central exon are of the same phase, phase I and phase II, respectively (i.e. they split a codon after the first or second base), thus suggesting that their divergence follows the division between defensin and mytilin/myticin [9], [43], [44] and [45]. After analysis of several clones from an individual mussel, it is suggested that there is one gene with two alleles. Similarly, a single copy of defensin and myticin genes has also been reported in the mussel genome [46].

Aiming to evaluate if the molecular variability detected in myticin C was a distinctive characteristic of this AMP, the sequence variation of the non-immune gene, β-actin, from 10 different mussels was investigated. The same sequence was obtained in all clones except two individual nucleotide changes, suggesting that the potential polymerasic errors could be excluded as an explanation of the high myticin C nucleotide variation. The variability of myticin C transcripts was further compared with that of 16S mitochondrial rRNA (data not shown), namely one EST cluster that originated from the same cDNA libraries showing a comparable EST abundance. According to the multi-alignment of sequence tracts of 302–303 base length, 8 parsimony-informative sites (SNPs found in more than one sequence) was detected, out of 30 variable sites in the 16S rRNA and 56 parsimony-informative sites out of 103 variable sites in the myticin C. Keeping in mind that the nucleotide substitution rate in the mtDNA is about 10 times faster than in nuclear DNA we can infer that myticin C sequences display an unexpectedly high variability, indicative of the elevated mutation rate observed in adaptively evolving gene regions. This finding reaffirms the putative role of myticin C as an immune effector protein directly interacting with PAMPs and also indicates the observed variation as a powerful resource for fighting old and new pathogens [47].

The high number of variants of myticin C found in this work contrasts with the only two myticin forms described previously. This high variability of AMPs has already been reported in other organisms [48], [49] and [50]. In aquatic invertebrates and precisely in shrimps (Litopenaeus sp.), several isoforms of the AMP penaeidin have been described. Analysis of their genomic structure and studies of their transcriptional regulation showed the existence of cis regulator elements and the presence of pseudogenes. These data suggest that the different forms of penaeidins evolved through multiple duplication events of a common ancestor [49].

In Drosophila and other Diptera, up to 8 types of extracellular antibiotic peptides have been described [45], [51] and [52]. Evidence of intronless genes for defensin, metchnikowin, drosomycins, diptericin and MPAC also suggest that their expression can occur despite stress-related depression of transcript maturation and translation. Genetic variability and circadian cycling are significant determinants of the immune competence in fruit fly and resistance to infection has been associated to nucleotide polymorphism of genes related to pathogen recognition and intracellular signaling rather than AMPs [40]. Despite the fact that insect AMPs tend to be highly conserved, the detection of two metchnikowin alleles in hundreds of experimentally infected fruit flies provide evidence of a natural polymorphism also for a single effector gene [51] and [53]. AMP amino acid variation, particularly in the processed signal and propeptide domains, as well as natural polymorphisms likely resulting in null alleles, have been described [54]. In contrast to the rapid adaptive evolution of other immune genes such as class C scavenger receptors and thioester-containing proteins, the higher synonymous substitution rate relative to the non-synonymous rate observed in the antifungal drosomycins and insect defensins suggests that invertebrate AMPs slowly evolve under purifying selection [45] and [54].

If purifying selection also underlies the evolution of mussel AMPs, other molecular mechanisms should be evoked to explain the transcript diversity detected in myticin C. In fact, alternative splicing in Drosophila immuno-competent cells, can generate extensively diversified isoforms of Dscam, a member of the immunoglobulin superfamily, and functional homologues of Rag proteins, known to mediate somatic gene rearrangement in jawed vertebrates, which are expressed during development and in adult tissues of the sea urchin [55], [56], [57] and [58].

These data are in agreement with those on the evolution of genes involved in response against pathogens since sequence diversity is a key feature of a relatively small number of effector molecules involved in self and non-self recognition [47] and [58]. In addition to the exemplary allele abundance of human HLA and to the hypervariability of immunoglobulin genes, sequence multiplicity increasingly appears as a landmark of pathogen recognition and receptor-mediated signaling of innate and adaptive immune responses. Actually, innate immunity is a powerful and ancient defence system in which PAMPs or infection by-products are recognized by receptors leading to regulated expression of immune modulators and antimicrobial molecules. Although molecular mechanisms of genetic variation are not generally defined, adaptive maintenance of sequence polymorphism likely reflects the co-evolution of host and pathogen species and their continuous and competitive interplay [40].

The constitutive expression of myticin in naive mussels can be indicative of its potential role in the immune system. This expression was tested in several organs, and the mantle was, the organ in which myticin C seems to be substantially expressed. Infiltrating hemocytes and, possibly, other AMP-expressing cells can be present in different tissues and developmental stages. The presence of myticin C was detected in early developmental stages. This finding contrasts with the expression of other mussel AMPs (mytilin B and MGD2) since these genes are not expressed in mussels until after larval settlement and metamorphosis, suggesting that they are developmentally regulated [46]. The expression of myticin C in mussel larval developmental stages may be used to explain its role in the apparent higher resistance to infections by mussels when compared with other economically important bivalves such as oysters and clams and supports the view that some immune defences are active during metamorphosis [46].

Future identification of pathway-specific and pathogen-specific responses in M. galloprovincialis could take advantage of gene transcription profiling based on MytArray 1.0 [36], a mussel cDNA microarray whose composition will be enriched by these transcripts. The overall results of this work as well as analysis of AMP sequence diversity of some hypervariable position could contribute to determine its specificity as antimicrobial molecules. A most extended study of these new AMPs will help to understand the role of these interesting molecules in the molluscs resistance against pathogens and external aggressions, improving the future aquaculture production.

Competing interests statement

The authors declare no competing financial interests.

Acknowledgments

We thank Philippe Roch for providing us the heat-inactivated bacterial cocktail and Gerolamo Lanfranchi for the critical manuscript reading. We also thank Sonia Dios for her help with the SSH libraries construction, Laura Varotto for her availability in experimental training activities , Cristiano De Pittà for evaluation of RNA quality, Begoña Villaverde and José R. Caldas for their technical assistance and Jeena Devasia for her English reading of the manuscript. This work was funded by the EC Integrated Project FOOD-CT-2005-007103 and AGL2003-02454 from the Ministerio de Ciencia y Tecnología (Spain), and, in part, by Quicksilver-Biotec Action (DGR 2112/02.08.2005 Veneto Region). M.M. Costa thanks the Ministerio de Educación y Ciencia for her predoctoral fellowship, and C. Gestal for her post-doctoral Ramon y Cajal contract.

References

[1] R.M. Zinkernagel and H. Hengartner, Protective ‘immunity’ by pre-existent neutralizing antibody titers and preactivated T cells but not by so-called ‘immunological memory’, Immunol Rev 211 (2006), pp. 310–319. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (14)

[2] S.T. Chisholm, G. Coaker, B. Day and B.J. Staskawicz, Host–microbe interactions: shaping the evolution of the plant immune response, Cell 124 (4) (2006), pp. 803–814. SummaryPlus | Full Text + Links | PDF (501 K) | View Record in Scopus | Cited By in Scopus (146)

[3] X.W. Wang, N.S. Tan, B. Ho and J.L. Ding, Evidence for the ancient origin of the NF-κB/IκB cascade: its archaic role in pathogen infection and immunity, Proc Natl Acad Sci USA 103 (11) (2006), pp. 4204–4209. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (12)

[4] T. Kawai and S. Akira, TLR signaling, Cell Death Differ 13 (5) (2006), pp. 816–825. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (115)

[5] S. Fasciano and L. Li, Intervention of Toll-like receptor-mediated human innate immunity and inflammation by synthetic compounds and naturally occurring products, Curr Med Chem 13 (12) (2006), pp. 1389–1395. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (7)

[6] J.P. Rast, L.C. Smith, M. Loza-Coll, T. Hibino and G.W. Litman, Genomic insights into the immune system of the sea urchin, Science 314 (5801) (2006), pp. 952–956. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (27)

[7] J. Kurtz and S.A. Armitage, Alternative adaptive immunity in invertebrates, Trends Immunol 27 (11) (2006), pp. 493–496. SummaryPlus | Full Text + Links | PDF (392 K) | View Record in Scopus | Cited By in Scopus (6)

[8] Z. Pancer and M.D. Cooper, The evolution of adaptive immunity, Annu Rev Immunol 24 (2006), pp. 497–518. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (44)

[9] P. Bulet, R. Stocklin and L. Menin, Anti-microbial peptides: from invertebrates to vertebrates, Immunol Rev 198 (2004), pp. 169–184. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (111)

[10] K.L. Brown and R.E. Hancock, Cationic host defense (antimicrobial) peptides, Curr Opin Immunol 18 (1) (2006), pp. 24–30. SummaryPlus | Full Text + Links | PDF (316 K) | View Record in Scopus | Cited By in Scopus (51)

[11] A. Peschel and H.G. Sahl, The co-evolution of host antimicrobial peptides and microbial resistance, Nat Rev Microbiol 4 (2006), pp. 529–536. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (31)

[12] S.T. Henriques, M.N. Melo and M.A. Castanho, Cell-penetrating peptides and antimicrobial peptides: how different are they?, Biochem J 399 (1) (2006), pp. 1–7. View Record in Scopus | Cited By in Scopus (8)

[13] G. Mitta, F. Vandenbulcke and P. Roch, Original involvement of antimicrobial peptides in mussel innate immunity, FEBS Lett 486 (3) (2000), pp. 185–190. SummaryPlus | Full Text + Links | PDF (1468 K) | View Record in Scopus | Cited By in Scopus (53)

[14] K. Terahara, K.G. Takahashi, A. Nakamura, M. Osada, M. Yoda and T. Hiroi et al., Differences in integrin-dependent phagocytosis among three hemocyte subpopulations of the Pacific oyster “Crassostrea gigas”, Dev Comp Immunol 30 (8) (2006), pp. 667–683. SummaryPlus | Full Text + Links | PDF (915 K) | View Record in Scopus | Cited By in Scopus (6)

[15] D.M. Bugge, H. Hegaret, G.H. Wikfors and B. Allam, Oxidative burst in hard clam (Mercenaria mercenaria) haemocytes, Fish Shellfish Immunol 23 (1) (2007), pp. 188–196. SummaryPlus | Full Text + Links | PDF (189 K) | View Record in Scopus | Cited By in Scopus (1)

[16] C.F. Ko, T.T. Chiou, B. Vaseeharan, J.K. Lu and J.C. Chen, Cloning and characterisation of a prophenoloxidase from the haemocytes of mud crab Scylla serrata, Dev Comp Immunol 31 (1) (2007), pp. 12–22. SummaryPlus | Full Text + Links | PDF (1667 K) | View Record in Scopus | Cited By in Scopus (3)

[17] E. Gosling, Diseases and parasites. In: E. Gosling, Editor, Bivalve molluscs biology, ecology and culture, Blackwell Science, Oxford, UK (2004), pp. 370–411 [Chapter 11].

[18] A. Figueras and B. Novoa, What has been going on in Europe in bivalve pathology?, Bull Eur Assoc Fish Pathol 24 (2004), pp. 16–21. View Record in Scopus | Cited By in Scopus (4)

[19] L. Diatchenko, Y.-F. Chris Lau, A.P. Campbell, A. Chenchik, F. Moqadam and B. Huang et al., Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries, Proc Natl Acad Sci USA 93 (1996), pp. 6025–6030. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (1600)

[20] S. Dios, L. Poisa-Beiro, A. Figueras and B. Novoa, Suppression subtraction hybridization (SSH) and macroarray techniques reveal differential gene expression profiles in brain of sea bream infected with nodavirus, Mol Immunol 44 (9) (2007), pp. 2195–2204. SummaryPlus | Full Text + Links | PDF (1262 K) | View Record in Scopus | Cited By in Scopus (3)

[21] D.A. Benson, I. Karsch-Mizrachi, D.J. Lipman, J. Ostell and D.L. Wheeler, GenBank, Nucleic Acids Res 3 (2007), pp. D21–D25. View Record in Scopus | Cited By in Scopus (19)

[22] S. Audic and J.M. Claverie, The significance of digital gene expression profiles, Genome Res 7 (1997), pp. 986–995. View Record in Scopus | Cited By in Scopus (347)

[23] C. Romualdi, S. Bortoluzzi, F. D’Alessi and G.A. Danieli, IDEG6: a web tool for detection of differentially expressed genes in multiple tag sampling experiments, Physiol Genomics 12 (2) (2003), pp. 159–162.

[24] D.J. Stekel, Y. Git and F. Falciani, The comparison of gene expression from multiple cDNA libraries, Genome Res 10 (12) (2000), pp. 2055–2061. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (83)

[25] S. Kumar, K. Tamura and M. Nei, MEGA: molecular evolutionary genetics analysis software for microcomputers, Comput Appl Biosci 10 (2) (1994), pp. 189–191. View Record in Scopus | Cited By in Scopus (461)

[26] J. Dyrløv Bendtsen, H. Nielsen, G. von Heijne and S. Brunak, Improved prediction of signal peptides: SignalP 3.0, J Mol Biol 340 (2004), pp. 783–795. SummaryPlus | Full Text + Links | PDF (2100 K)

[27] G. Pollastri and A. McLysaght, Porter: a new, accurate server for protein secondary structure prediction, Bioinformatics 21 (8) (2005), pp. 1719–1720. View Record in Scopus | Cited By in Scopus (38)

[28] K.J. Livak and T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(−delta delta C(T)) method, Methods 25 (2001), pp. 402–408. Abstract | Abstract + References | PDF (713 K) | View Record in Scopus | Cited By in Scopus (3999)

[29] P.D. Thomas, H. Mi and S. Lewis, Ontology annotation: mapping genomic regions to biological function, Curr Opin Chem Biol 11 (1) (2007), pp. 4–11. SummaryPlus | Full Text + Links | PDF (986 K) | View Record in Scopus | Cited By in Scopus (5)

[30] E.M. Zdobnov and R. Apweiler, InterProScan—an integration platform for the signature-recognition methods in InterPro, Bioinformatics 17 (9) (2001), pp. 847–848. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (229)

[31] H. Tamaoki, R. Miura, M. Kusunoki, Y. Kyogoku, Y. Kobayashi and L. Moroder, Folding motifs induced and stabilized by distinct cystine frameworks, Protein Eng 11 (8) (1998), pp. 649–659. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (48)

[32] F. Tajima and M. Nei, Estimation of evolutionary distance between nucleotide sequences, Mol Biol Evol 1 (3) (1984), pp. 269–285. View Record in Scopus | Cited By in Scopus (303)

[33] Y. Gueguen, J.P. Cadoret, D. Flament, C. Barreau-Roumiguière, A.L. Girardot and J. Garnier et al., Immune gene discovery by expressed sequence tags generated from hemocytes of the bacteria-challenged oyster, Crassostrea gigas, Gene 303 (2003), pp. 139–145. SummaryPlus | Full Text + Links | PDF (163 K) | View Record in Scopus | Cited By in Scopus (49)

[34] A. Tanguy, X. Guo and S.E. Ford, Discovery of genes expressed in response to Perkinsus marinus challenge in Eastern (Crassostrea virginica) and Pacific (C. gigas) oysters, Gene 338 (2004), pp. 121–131. SummaryPlus | Full Text + Links | PDF (251 K) | View Record in Scopus | Cited By in Scopus (26)

[35] Y.S. Kang, Y.M. Kim, K.Ll. Park, S.K. Cho, K.S. Choi and M. Cho, Analysis of EST and lectin expression in hemocytes of Manila clams (Ruditapes phylippinarum) (Bivalvia: Mollusca) infected with Perkinsus olseni, Dev Comp Immunol 30 (12) (2006), pp. 1119–1131. SummaryPlus | Full Text + Links | PDF (460 K) | View Record in Scopus | Cited By in Scopus (6)

[36] P. Venier, C. De Pitta, A. Pallavicini, F. Marsano, L. Varotto and C. Romualdi et al., Development of mussel mRNA profiling: can gene expression trends reveal coastal water pollution?, Mutat Res 602 (1–2) (2006), pp. 121–134. SummaryPlus | Full Text + Links | PDF (739 K) | View Record in Scopus | Cited By in Scopus (5)

[37] Gestal C, Costa MM, Figueras A, Novoa B. Analysis of differentially expressed genes in response to bacterial stimulation in hemocytes of the carpet-shell clam Ruditapes decussatus: identification of new antimicrobial peptides. Gene, in press.

[38] M. Charlet, S. Chernysh, H. Philippe, C. Hetru, J.A. Hoffmann and P. Bulet, Innate immunity. Isolation of several cysteine-rich antimicrobial peptides from the blood of a mollusc, Mytilus edulis, J Biol Chem 271 (36) (1996), pp. 21808–21813. View Record in Scopus | Cited By in Scopus (111)

[39] N. Sitaram, Antimicrobial peptides with unusual amino acid compositions and unusual structures, Curr Med Chem 13 (6) (2006), pp. 679–696. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (4)

[40] B.P. Lazzaro, T.B. Sackton and A.G. Clark, Genetic variation in Drosophila melanogaster resistance to infection: a comparison across bacteria, Genetics 174 (3) (2006), pp. 1539–1554. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (5)

[41] S. Zhu, B. Gao and J. Tytgat, Phylogenetic distribution, functional epitopes and evolution of the CSalphabeta superfamily, Cell Mol Life Sci 62 (19–20) (2005), pp. 2257–2269. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (13)

[42] B. Romestand, F. Molina, V. Richard, P. Roch and C. Granier, Key role of the loop connecting the two beta strands of mussel defensin in its antimicrobial activity, Eur J Biochem 270 (13) (2003), pp. 2805–2813. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (20)

[43] H. Zhang and Y. Kato, Common structural properties specifically found in the CSαβ-type antimicrobial peptides in nematodes and mollusks: evidence for the same evolutionary origin?, Dev Comp Immunol 27 (6–7) (2003), pp. 499–503. SummaryPlus | Full Text + Links | PDF (206 K) | View Record in Scopus | Cited By in Scopus (15)

[44] Y. Gueguen, A. Herpin, A. Aumelas, J. Garnier, J. Fievet and J.M. Escoubas et al., Characterization of a defensin from the oyster Crassostrea gigas. Recombinant production, folding, solution structure, antimicrobial activities, and gene expression, J Biol Chem 281 (1) (2006), pp. 313–323. View Record in Scopus | Cited By in Scopus (16)

[45] R.S. Dassanayake, Y.I. Silva Gunawardene and S.S. Tobe, Evolutionary selective trends of insect/mosquito antimicrobial defensin peptides containing cysteine-stabilized α/β motifs, Peptides 28 (1) (2007), pp. 62–75. SummaryPlus | Full Text + Links | PDF (1409 K) | View Record in Scopus | Cited By in Scopus (2)

[46] G. Mitta, F. Hubert, E.A. Dyrynda, P. Boudry and P. Roch, Mytilin B and MGD2, two antimicrobial peptides of marine mussels: gene structure and expression analysis, Dev Comp Immunol 24 (4) (2000), pp. 381–393. SummaryPlus | Full Text + Links | PDF (1379 K) | View Record in Scopus | Cited By in Scopus (29)

[47] Garrigan D, Hedrick PW. Perspective: detecting adaptive molecular polymorphism: lessons from the MHC. Evolution 2003;57(8):1707–22.

[48] Y. Radhakrishnan, K.G. Hamil, S. Yenugu, S.L. Young, F.S. French and S.H. Hall, Identification, characterization, and evolution of a primate beta-defensin gene cluster, Genes Immun 6 (3) (2005), pp. 203–210. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (15)

[49] N.A. O’Leary and P.S. Gross, Genomic structure and transcriptional regulation of the penaeidin gene family from Litopenaeus vannamei, Gene 371 (1) (2006), pp. 75–83.

[50] A. Ohnuma, J.M. Conlon, K. Yamaguchi, H. Kawasaki, L. Coquet and J. Leprince et al., Antimicrobial peptides from the skin of the Japanese mountain brown frog Rana ornativentris: evidence for polymorphism among preprotemporin mRNAs, Peptides 28 (3) (2007), pp. 524–532. SummaryPlus | Full Text + Links | PDF (624 K) | View Record in Scopus | Cited By in Scopus (6)

[51] J.L. Imler and P. Bulet, Antimicrobial peptides in Drosophila: structures, activities and gene regulation, Chem Immunol Allergy 86 (2005), pp. 1–21. View Record in Scopus | Cited By in Scopus (23)

[52] S. Kurata, Recognition and elimination of diversified pathogens in insect defense systems, Mol Divers 10 (4) (2006), pp. 599–605. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (3)

[53] B.P. Lazzaro and A.G. Clark, Molecular population genetics of inducible antibacterial peptide genes in Drosophila melanogaster, Mol Biol Evol 20 (6) (2003), pp. 914–923. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (27)

[54] F.M. Jiggins and K.W. Kim, The evolution of antifungal peptides in Drosophila, Genetics 171 (4) (2005), pp. 1847–1859. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (6)

[55] G.W. Litman, J.P. Cannon and J.P. Rast, New insights into alternative mechanisms of immune receptor diversification, Anesthesiology 103 (3) (2005), pp. 484–488.

[56] F.L. Watson, R. Puttmann-Holgado, F. Thomas, D.L. Lamar, M. Hughes and M. Kondo et al., Extensive diversity of Ig-superfamily proteins in the immune system of insects, Science 309 (5742) (2005), pp. 1874–1878. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (75)

[57] S.D. Fugmann, C. Messier, L.A. Novack, R.A. Cameron and J.P. Rast, An ancient evolutionary origin of the Rag1/2 gene locus, Proc Natl Acad Sci USA 103 (10) (2006), pp. 3728–3733. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (17)

[58] Y. Xu, DNA damage: a trigger of innate immunity but a requirement for adaptive immune homeostasis, Nat Rev Immunol 6 (4) (2006), pp. 261–270. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (9)

Appendix A. Supplementary data

(275 K)
f.xls    
Microsoft Excel file 1.

Supplemental Table S1. Annotation and relative abundance of transcript sequence tags from the hemolymph of immune-stimulated mussels. Cluster ID, EST abundance and library of origin, BLAST similarity searches (putative identity, e-value, used algorithm, database)